The study was conducted in West Gondar Metema district, which is located about 900 km North West of Addis Ababa and about 160 and 340 km west of Gondar and Bahir Dar towns respectively. It is one of the west Districts of Ethiopia bordering the Sudan. The district has twenty kebeles of which 18 are rural-based peasant administrations. The altitude of the district ranges from 550 to 1608 meters above sea level. Its minimum annual temperature ranges between 220c and 280c. The daily temperature is higher from March to May and sometimes reaches 430c. The District is considerably lowland with exception of some mountaintops 5. The mean annual rainfall ranges from about 850 mms to 1100 mms, with a unimodal distribution. Thus, the rainy months extend from June to the end of September.

The district is known for cultivation of various cereals. About 90% of the district s cultivated areas of Kokit, Korjamus, Dellello, Senare and Korhumer are covered by predominantly sesame followed by cotton and maize which are currently important marketable crops. (Figure 1 )

An experimental; Completely Randomized Design (CRD) was used to assess the availability and environmental impacts of unauthorized GM seeds in the study area and employed.

Quadrant or plot and simple random sampling techniques were implemented to choose crop samples to be tested in the laboratory. Sampling sites of farms were plotted in quadrants and for each quadrant; samples on the basis of simple random sampling technique were collected and recorded in codes. A quadrat is often a square frame that is set directly on top of the plants and is done using ropes. Plots are another name for quadrats. Plot or quadrat-based cover methods are essentially estimations of how much ground a plant will cover in a specific space. Plot-based techniques are not as effective for foliar or basal cover and are used to measure the amount of canopy cover that exists on a location. The majority of plot-based techniques aren't effective for trees or shrubs because they're mostly made to estimate the cover of herbaceous plants.

In the study area, cotton and maize crops were collected from farm land through the quadrant method during the farming season. All collected crop samples were preserved through standard botanical techniques and transported to the laboratory. To detect the existence of horizontal gene transfer and impact on the environment, sesame, sunflower, sorghum, weeds, diseased crops, and water samples were collected and transferred to the laboratory. All collected samples were tested and analyzed by standard testing procedures.

A total of 210 samples (forty-five cotton, forty-five maize, thirty sunflower, thirty Sesame, thirty sorghum, and thirty weed samples) have been used for DNA extraction. Genomic DNA from all collected samples was isolated by using the Cetyl Trimethyl Ammonium Bromide (CTAB) method with some modifications of 7. The DNA samples were dried and stored at -20 °C for further use. Detection of DNA from water samples were done through Dische Diphenylamine Test according to 6.

The extracted DNA was used as a template in PCR analysis and Conventional PCR was used for detection of GM genes with a specific set of primers. Cotton common GM gene was amplified with forward primer sequence (F CACATGACTTAGCCCATCTTTGC and a reverse primer (R,CCCACCCTTTTTTGGTTTAGC ), Maize common GM gene was detected by using primer sequences(F CGTCGTTTCCCATCTCTTCCTCC and R, CCACTCCGAGACCCTCAGTC), Bt176 gene was amplified by using specific primers (F,GGCCGTGAACGAGCTGTT and R, GGGAAGAAGCCTACATGTTTTCTAA) and the Bt11 gene was detected by specific set of primers (F, GCGGAACCCCTATTTGTTTA, and R, TCCAAGAATCCCTCCATGAG) 9. All the PCR reactions were performed in a final volume of 25 μl reaction mixtures containing 0.5 μl of 10 pmole for each forward and reverse Primer, 2 μl of 2.5 mM of dNTP, 0.4 of 1 unit Taq polymerase, 2 μl of 10x PCR buffer, 1.5 μl of 25mM MgCl2, 15.1 μl double distilled water and finally 3μl of 100 ng template DNA for one reaction for 35 cycles.

The PCR reaction for common Bt cotton gene and maize was carried out using a master cycler gradient (Eppendorf thermal cycler gradient 5331) with the following thermal cycling conditions, Initial denaturation, 95°C for 7 min, Final denaturation, 94°C for 1 min, Annealing, 59°C for cotton and 54°C for maize for 45sec, extension, 72°C for 30 sec, the final extensions was 7 min at 72°C and final hold at 4°C. On the other hand, thermal cycler conditions for Bt-11 and Bt-176 were as follows: Initial denaturation at 95°C for 4 min, denaturation at 95°C for 50 sec, primer annealing for 45 sec, 52°C for Bt-11 and 54°C for Bt 176 primers, primer extension at 72°C for 50 sec; and a final elongation at 72°C for 5 minutes 10. The PCR product was subjected to gel electrophoresis containing 2% agarose.

The data were analyzed using the SPSS (statistical package software for social science) software package version 20 for window. SPSS is a software program used by researchers in various disciplines for quantitative analysis of complex data. Occurrence and frequency of transgene were analyzed via descriptive statistics of cross tabulation and frequency for each treatment in their corresponding experimental unit.

Different crop samples were collected from the trans boundary areas of Ethiopia and Sudan for detection of genetically modified crops, assessment of its environmental impact, and the prevalence of horizontal gene transfer. A total of 210 samples of smuggled and domestic crops of cotton, maize, sunflower, sorghum, weeds, and sesame were collected from Metema farming areas of Kokit, Korjamus, Dellelo, Senare and Korhumer. The Isolated DNA quality and quantity was determined with 1% Agarose gel electrophoresis (Figure 2).

The environmental DNA from water bodies was checked by Dische Diphenylamine Test and 3(100%) clear colored result was observed from water collected from Guang River and blue color was observed from the control of DNA samples (Table 1).

PCR analyses were carried out for different transgenes of cotton GM gene, maize GM gene, Bt-176 gene, and Bt-11 gene with their corresponding plant-specific primers to confirm the presence of GM crops. A product of 277 bp was observed from smuggled cotton samples as shown below in Figure 3. Out of 45 cotton samples, 15(33.3%) of them were PCR positive and 30(66.7%) were PCR negative (Table 2).

On the other hand PCR amplification was conducted for maize GM gene by specific set of primer sequences of (F’CGTCGTTTCCCATCTCTTCCTCC and R,CCACTCCGAGACCCTCAGTC). A product of 226bp was observed (Figure 4) of them 14(31.8%) were seed of smuggled maize showing positive PCR product and 30(68.2%) of total maize samples were PCR negative (Table 3).

PCR for transgene Bt-176 was run using a specific set of primer sequences (F,GGCCGTGAACGAGCTGTT and R,GGGAAGAAGCCTACATGTTTTCTAA). The PCR product obtained was checked on 2% agarose gel electrophoresis, with a 100 bp ladder ran parallel to check the size of amplicon. A product of 211bp was observed (Figure 4, Figure 5, Figure 6). From overall, 14(31.8%) were smuggled Bt maize and 30(68.2%) maize samples showed no PCR amplification product.

PCR for another transgene Bt-11 was conducted using a specific set of primer sequences (F, GCGGAACCCCTATTTGTTTA, and R, TCCAAGAATCCCTCCATGAG). The PCR product was checked on 2% Agarose gel electrophoresis with a 100bp ladder and 189 amplification products was observed (Figure 6). Smuggled Bt maize of 14(31.8%) were detected and 30(68.2%) of total maize samples showed no PCR product (Table 4).

DNA extracted from domestic cotton, maize, sesame, diseased plants, weeds and sorghum samples were run on PCR with all four set of primers and there were 0 (0.0%) amplification products from all set of primers except smuggled cotton and maize samples (Table 4).

Before the development of Bt cotton, pest impact on cotton growers was significant. Farmers were losing a lot of their cotton due to H. virescens and the pink bollworm, Pectinophora gossypiella, because of synthetic insecticide resistance. Nineteen four persont of the cotton grown in the USA is genetically engineered 8.

According to a research by the University of California, the average cost reduction for pesticides used in Bt cotton fields from 1996 to 1998 was between 25 and 65 dollars per acre. During the same time period, it was also projected that the yield was 5% higher than that of traditional cotton. Additionally, Bt cotton dramatically reduced the need for foliar treatments to combat other cotton pests, which in turn reduced the price of pesticides 16. The first Bt cotton to be sold in the USA was Bollgard cotton, a Monsanto Company brand, in 1996. It was manufacturing the Cry1Ac toxin, which was highly active against pink bollworm and tobacco budworm. Farmers in the Western Cotton Belt of the USA mainly used bt cotton to combat pink bollworm, while farmers in the Mid-South and South-East used it to combat tobacco budworm, fall armyworm, Spodoptera frugiperda, and S. exigua to a lesser extent (Stewart 2007).

The present study provides a simple and reliable conventional PCR method for detecting genetically engineered crops and its environmental impact assessment. In this study, the presence of horizontal gene transfer was also assessed. For PCR analysis, qualified and quantified DNA was extracted from different crop samples and the occurrence of Bt gene from the extracted DNA was checked by a different specific set of primers. Dische Diphenylamine Test was conducted to detect the DNA from water collected from Guang river, and the result showed that there were no Environmental DNA from water bodies. For the achievement of research objectives, different PCR analyses were carried out using specific primers of common Bt cotton, common Bt maize, Bt-11, and Bt-176.

In the present study, the presence of Bt cotton was confirmed by plant-specific primers of common Bt cotton gene . The results showed that a PCR product with 277bp was observed after PCR reaction. The result of this revealed that 15(33.3%) were bt cotton from overall 45(100%) cotton samples. However, the Bt gene was found in the smuggled cotton other than 0(0.0%) of domestic and diseased cotton samples of 15(33.3%) for each. This result was in line with 24; 3 studies of PCR based detection of transgenic cotton seed samples and also agree with 18 PCR based detection of transgenic rice. The results of this study indicates that Bt cotton is Smuggled from Sudan and cultivated in the all studied areas of Kokit, Korjamus, Dellello, Senare, and Korhumer on Metema, Ethiopia.

In this study, the PCR assay was carried out, primers specific to inserted genes of common Bt maize were used, and 226bp were observed from PCR products. The result implies that 14(31.8%) were Bt maize from a total of 44(100.0%) maize samples and the Bt maize were smuggled from Sudan. However, 30(68.2%) of Domestic and diseased maize samples have 0(0.0%) Bt gene. This result was also in agreement with previous reports, Detection of Genetically Modified Maize by Polymerase Chain Reaction (12; Payam et al., 2020; 10. The results of this study also revealed that Bt Maize is smuggled from Sudan and cultivated in the studied areas of Ethiopia.

In the present study, PCR assay was conducted for a specific gene of primers specific to inserted genes in the event 176 GM maize. Bt-176 genes were observed with 211bp in smuggled maize samples and 14(31.8%) had Bt gene from overall samples of 44(100.0%) maize and 30(68.2%) of Domestic and diseased maize samples have 0(0.0%) cry genes. Likewise, other scholars also reported Detection of Genetically Modified Maize in Processed Foods by Polymerase Chain Reaction (Maher et al., 2013; 10; 13. The result of this study indicates that event 176 GM maize is smuggled from Sudan and cultivated in the studied areas of Ethiopia.

In this work, PCR analysis was conducted using specific gene primers specific to inserted genes in the event 11 GM maize. Bt gene of Bt-11 was observed and had 189bp in smuggled maize samples and 14(31.8%) had Bt gene from overall samples of 44(100.0%) maize and 30(68.2%) of Domestic and diseased maize samples were 0(0.0%) Bt gene. This result was in agreement with other researchers of PCR-based detection of genetically modified soy and maize products (Payam et al., 2020; Maher et al., 2013; 10; 13. The result of this study shows that Event 11 GM maize is smuggled from Sudan and cultivated in the studied areas of Metema woreda.

In the present study, Environmental impacts of unauthorized GM genes were assessed from all diseased samples with all four sets of primers and there were 0.0% Bt genes. The result of this study is in agreement with the previous report, Ecological safety evaluation of transgenic cotton and Ecosystem Impacts of Pesticide Reductions 25; 19. The result of this study implies that the Bt gene might have no negative environmental impacts.

In this study, horizontal gene transfers of unauthorized GM genes were determined from samples of domestic and indigenous crops with all four sets of primers and there were 0.0% Bt genes. However, according to 2. Horizontal Gene Transfer occurred between Plants. In addition to these, Dische Diphenylamine Test showed that DNA was not detected in water and implies, the transgene might not transfer through the water. The results of this study declared that there is no horizontal GM gene transfer to other crops on the study area of Ethiopia.

In general, after detection of genetically modified crops, a polymerase chain reaction (PCR) assay with primers specific to inserted genes was performed in this study. According to PCR results, 28 (13.4%) of the 209 (100%) tested specimens revealed a positive response to the Bt gene primer. The results showed 28 (13.4%) were Bt crops and 181(86.6%) were non-GM from overall sample. The results of the present study confirmed that transgenic Bt crops of cotton and maize are smuggled from Sudan and cultivated in the studied areas of Ethiopia.