<?xml version="1.0" encoding="utf8"?>
 <!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.0 20120330//EN" "http://jats.nlm.nih.gov/publishing/1.0/JATS-journalpublishing1.dtd"> <article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="1.0" xml:lang="en">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">JVHC</journal-id>
      <journal-title-group>
        <journal-title>Journal of Veterinary Healthcare</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2575-1212</issn>
      <publisher>
        <publisher-name>Open Access Pub</publisher-name>
        <publisher-loc>United States</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="publisher-id">JVHC-20-3477</article-id>
      <article-id pub-id-type="doi">10.14302/issn.2575-1212.jvhc-20-3477</article-id>
      <article-categories>
        <subj-group>
          <subject>research-article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Aerobic Plate Count of Contaminants and Molecular Characterization of <italic>Eschereichia</italic><italic> Coli</italic> in Raw Chicken Meat in Ismailia, Egypt</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>El-Sayed</surname>
            <given-names>A. Afify</given-names>
          </name>
          <xref ref-type="aff" rid="idm1843087044">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Fahim</surname>
            <given-names>A Shaltout</given-names>
          </name>
          <xref ref-type="aff" rid="idm1843087044">1</xref>
          <xref ref-type="aff" rid="idm1843086540">*</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Zakaria,</surname>
            <given-names>I. M</given-names>
          </name>
          <xref ref-type="aff" rid="idm1843087044">1</xref>
        </contrib>
      </contrib-group>
      <aff id="idm1843087044">
        <label>1</label>
        <addr-line>Department of Food Control, Faculty of Veterinary Medicine, Benha University. Animal Health Research Institute, Dokki, Giza.</addr-line>
      </aff>
      <aff id="idm1843086540">
        <label>*</label>
        <addr-line>corresponding author</addr-line>
      </aff>
      <contrib-group>
        <contrib contrib-type="editor">
          <name>
            <surname>María</surname>
            <given-names>Del Refugio Castañeda-Chávez</given-names>
          </name>
          <xref ref-type="aff" rid="idm1842917788">1</xref>
        </contrib>
      </contrib-group>
      <aff id="idm1842917788">
        <label>1</label>
        <addr-line>Tecnológico Nacional de México/Instituto Tecnológico de Boca del Río, 94290 Veracruz, Mexico.</addr-line>
      </aff>
      <author-notes>
        <corresp>
    
    Fahim A Shaltout, <addr-line>Department of Food Control, Faculty of Veterinary Medicine, </addr-line><addr-line>Benha</addr-line><addr-line> University, Egypt</addr-line>, Email: <email>fahim.shaltout@fvtm.bu.edu.eg</email></corresp>
        <fn fn-type="conflict" id="idm1850786556">
          <p>The authors have declared that no competing interests exist.</p>
        </fn>
      </author-notes>
      <pub-date pub-type="epub" iso-8601-date="2020-09-20">
        <day>20</day>
        <month>09</month>
        <year>2020</year>
      </pub-date>
      <volume>2</volume>
      <issue>2</issue>
      <fpage>23</fpage>
      <lpage>30</lpage>
      <history>
        <date date-type="received">
          <day>08</day>
          <month>07</month>
          <year>2020</year>
        </date>
        <date date-type="accepted">
          <day>31</day>
          <month>08</month>
          <year>2020</year>
        </date>
        <date date-type="online">
          <day>20</day>
          <month>09</month>
          <year>2020</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>© </copyright-statement>
        <copyright-year>2020</copyright-year>
        <copyright-holder>El-Sayed A. Afify, et al.</copyright-holder>
        <license xlink:href="http://creativecommons.org/licenses/by/4.0/" xlink:type="simple">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <self-uri xlink:href="http://openaccesspub.org/jvhc/article/1458">This article is available from http://openaccesspub.org/jvhc/article/1458</self-uri>
      <abstract>
        <p>A total number of 100 samples from ten random broiler chicken carcasses (breast and thigh) were collected from an automatic poultry slaughtering plant in Ismailia city, Egypt. The mean values of Enterobacteriacae count were 5.9x104±9.7x103 cfu/g and 7.1x 104 ± 1.1x104  cfu/g for chicken breast and thigh samples respectively. The prevalence of <italic>E.coli</italic> were 12% and 9% breast and thigh samples examined, respectively. They are serologically identified as 33.35 and 22.2% O<sub>157</sub>:H<sub>7</sub> (EHEC) , 16.6% and 11.1% O114:H21(EPEC), 16.6% and 33.3 %O127:H6 (ETEC) , 0% and 0%  O126 (ETEC) and  33.3% and 0% O26 (EHEC) for breast and thigh samples, respectively. The incidence of <italic>E.coli</italic> O<sub>157</sub>:H<sub>7  </sub>was 100% in both serological and PCR methods from biochemical positive <italic>E.coli</italic> samples. Culture is specific and cheap whereas PCR is sensitive and expensive, hence, we recommend both culture and molecular methods, which improve sensitivity and specificity, to enhance detection of foodborne pathogens including <italic>E.coli</italic><italic>.</italic></p>
      </abstract>
      <kwd-group>
        <kwd>Chicken meat</kwd>
        <kwd>Identification</kwd>
        <kwd>characterization</kwd>
        <kwd>E.coli</kwd>
        <kwd>PCR</kwd>
      </kwd-group>
      <counts>
        <fig-count count="1"/>
        <table-count count="6"/>
        <page-count count="8"/>
      </counts>
    </article-meta>
  </front>
  <body>
    <sec id="idm1842913324" sec-type="intro">
      <title>Introduction</title>
      <p><bold>C</bold>hicken meat is one of the most popular foods among developed and developing countries .It contains essential amino acids, minerals including sodium, potassium calcium, iron, phosphorous besides, and traces of vitamins such as vitamin B12 and niacin required for growth and carry on life<xref ref-type="bibr" rid="ridm1842708428">1</xref>. </p>
      <p>Chicken meat is a common source of pathogenic bacteria such as <italic>Escherichia coli </italic><xref ref-type="bibr" rid="ridm1842709148">2</xref>. </p>
      <p>Poultry meat is an ideal medium for bacterial growth and is known to harbor a large number of bacteria that are pathogenic to human. Typically, contamination with bacteria occur in low sanitation levels, and only pose a threat to the consumer if the product is not handled.</p>
      <p><italic>Escherichia coli </italic>is considered as a commensal in the alimentary tract of domestic and wild animals as well as man. <italic>E. coli </italic>isone of the important food borne pathogen of public health interest incriminated in poultry meat worldwide<xref ref-type="bibr" rid="ridm1842701948">3</xref>. <italic>E. coli</italic><italic>O157:H7</italic> has the ability to tolerate acidic condition of the stomach, The infective dose of <italic>E.coli</italic><italic> O157:H7 </italic>ranges from 10 to 100 cells /g<xref ref-type="bibr" rid="ridm1842718556">4</xref>.</p>
      <p>The detection of foodborne pathogens using conventional culture methods have been considered as the “gold standard” for the isolation and identification of foodborne bacterial pathogens<xref ref-type="bibr" rid="ridm1842780492">5</xref>. Culture steps include nonselective enrichment, selective enrichment,  selective/differential plating, morphological, biochemical and serological confirmation. Culture isolation and identification is known to be specific and inexpensive, but method is labor-intensive and time-consuming, because it require at least, three working days to produce a negative result and five to ten working days for confirming positive results. Moreover, due to environmental factors, variations in gene expression of microorganisms can occur and may affect the results of biochemical tests. Viable but non cultivable cells are not detected by the conventional cultural methods<xref ref-type="bibr" rid="ridm1842571172">6</xref>.</p>
      <p>Polymerase chain reaction (PCR) is a method used for the <italic>in vitro</italic> enzymatic synthesis of specific DNA sequences by Taq or other thermo resistant DNA polymerases. PCR uses oligonucleotide primers that are usually 20-30 nucleotides in length and whose sequence is homologous to the ends of the genomic DNA region to be amplified. The method is performed in repeated cycles, so that the products of one cycle serve as the DNA template for the next cycle, doubling the number of target DNA copies in each cycle<xref ref-type="bibr" rid="ridm1842569300">7</xref>. PCR represents a rapid procedure with high sensitivity and specificity for the immediate detection and identification of specific pathogenic bacteria from different food materials<xref ref-type="bibr" rid="ridm1842567212">8</xref>.</p>
    </sec>
    <sec id="idm1842907700" sec-type="materials">
      <title>Material and Methods </title>
      <sec id="idm1842907988">
        <title>Collection of Samples</title>
        <p>A total of 100 samples from ten random broiler chicken carcasses (about 2kg in weight) were collected after complete preparation involving (washing in achiller, slaughtering, scalding, defeathering and evisceration), at an automatic poultry slaughtering plant in Ismailia city, Egypt. The samples were kept separately in plastic bags, and transported immediately to the laboratory in an insulated ice box under aseptic conditions.</p>
      </sec>
      <sec id="idm1842907196">
        <title>Bacteriological Examination</title>
      </sec>
      <sec id="idm1842907340">
        <title>Conventional Recovery Methods</title>
        <sec id="idm1842908276">
          <title>Preparation of Samples</title>
          <p>The samples were prepared according to the technique recommended ICMSF<xref ref-type="bibr" rid="ridm1842572324">9</xref>.</p>
          <p>Twenty-five grams of a samples was taken by sterile scissors and forceps after surface sterilization by hot spatula, then transferred to sterile polyethylene bags, to which 225 ml of 0.1% of sterile buffered peptone water (0.1%) was aseptically added. Each sample was then homogenized for 2 minutes at 2500 r.p.m. using a sterile homogenizer to achieve 1/10 dilution. The homogenate was allowed to stand for 15 minutes at room temperature. One ml from such dilution was transferred to a second sterile tube containing 9 ml sterile buffered peptone water and mixed well. Further decimal serial dilutions were prepared accordingly. This samples of all groups were subjected to the following examination. </p>
          <p>Determination of aerobic plate count<xref ref-type="bibr" rid="ridm1842560972">10</xref>:was conducted: using standard plate count agar media. While, Determination of Enterobacteriaceae count<xref ref-type="bibr" rid="ridm1842557444">11</xref> was conducted :using violet red bile glucose agar media (VRBG). Isolation and Identification of E.coli<xref ref-type="bibr" rid="ridm1842559172">12</xref>: using MacConkey broth and Eosin Methylene blue plates. The metallic green colonies were picked up and identified biochemically and serologically.                                                                                          </p>
        </sec>
      </sec>
      <sec id="idm1842904964">
        <title>Polymerase Chain Reaction (PCR)</title>
        <p>For confirmation of isolated strains and for detection of shiga toxin1 and shiga toxin2 <xref ref-type="bibr" rid="ridm1842556148">13</xref>,<xref ref-type="bibr" rid="ridm1842550004">14</xref>. </p>
      </sec>
      <sec id="idm1842905324">
        <title>DNA Extraction</title>
        <p>DNA extraction from samples was performed using the QIAamp DNA Mini kit (Qiagen, Germany, GmbH) according to manufacturer’s recommendations with modifications. Briefly, 200 µl of the sample suspension was incubated with 10 µl of proteinase K and 200 µl of lysis buffer at 56<sup>O</sup>C for 10 min. After incubation, 200 µl of 100% ethanol was added to the lysate. The sample was then washed and centrifuged following the manufacturer’s recommendations. Nucleic acid was eluted with 100 µl of elution buffer.</p>
      </sec>
      <sec id="idm1842905108">
        <title>Oligonucleotide Primer</title>
        <p>Primers used were supplied from Metabion (Germany) (<xref ref-type="table" rid="idm1843237676">Table 1</xref>) </p>
        <table-wrap id="idm1843237676">
          <label>Table 1.</label>
          <caption>
            <title> Primers sequences, target genes, amplicon sizes and cycling conditions.</title>
          </caption>
          <table rules="all" frame="box">
            <tbody>
              <tr>
                <td>Target gene</td>
                <td>Primers           sequences</td>
                <td>Amplified segment (bp)</td>
                <td>Primarydenaturation</td>
                <td colspan="3">Amplification (35 cycles)</td>
                <td>Final  extension</td>
                <td>Reference</td>
              </tr>
              <tr>
                <td/>
                <td/>
                <td/>
                <td/>
                <td>Secondary denaturation</td>
                <td>Annealing</td>
                <td>Extension</td>
                <td> </td>
                <td/>
              </tr>
              <tr>
                <td>
                  <italic>E.coli</italic>
                  <italic> O157:H7 </italic>
                  <italic>fliC</italic>
                </td>
                <td>GCGCTGTCGAGTTCTATCGAGC</td>
                <td>625</td>
                <td>94˚C5 min.</td>
                <td>94˚C30 sec.</td>
                <td>57˚C40 sec.</td>
                <td>72˚C45 sec.</td>
                <td>72˚C10 min.</td>
                <td>
                  <xref ref-type="bibr" rid="ridm1842546692">15</xref>
                </td>
              </tr>
              <tr>
                <td/>
                <td>CAACGGTGACTTTATCGCCATTCC</td>
                <td/>
                <td/>
                <td/>
                <td/>
                <td/>
                <td/>
                <td/>
              </tr>
            </tbody>
          </table>
        </table-wrap>
      </sec>
      <sec id="idm1842869988">
        <title>PCR Amplification</title>
        <p>Primers were utilized in a 25µl reaction containing 12.5 µl of EmeraldAmp Max PCR Master Mix (Takara, Japan), 1 µl of each primer of 20 pmol concentration, 4.5 µl of water, and 6 µl of DNA template. The reaction was performed in an Applied biosystem 2720 thermal cycler.</p>
      </sec>
      <sec id="idm1842870204">
        <title>Analysis of the PCR Products.</title>
        <p>The products of PCR were separated by electrophoresis on 1.5% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature using gradients of 5V/cm. For gel analysis, 20 µl of the products was loaded in each gel slot. Generuler 100 bp ladder (Fermentas, Germany) was used to determine fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra) and the data was analyzed through computer software. </p>
      </sec>
      <sec id="idm1842870636">
        <title>Statistical Analysis</title>
        <p>All the obtained results were evaluated statistically using Analysis of variance (״Anova test) statistic “<xref ref-type="bibr" rid="ridm1842551516">16</xref>.</p>
      </sec>
    </sec>
    <sec id="idm1842869772" sec-type="results">
      <title>Results</title>
      <p>The initial (cfu/g) mean values of aerobic plate count of fresh chicken breast and thigh samples were 5.1x10<sup>4</sup> ±3.2x10<sup>4</sup> cfu/g and 6.1x10<sup>5</sup>±5.6x10<sup>5</sup> cfu/g respectively (<xref ref-type="table" rid="idm1843177052">Table 2</xref>). The initial (cfu/g) mean values of total Enterobacteriaceae count of fresh chicken breast and thigh samples were 5.9x10<sup>4</sup>±9.7x10<sup>3</sup> cfu/g (<xref ref-type="table" rid="idm1843157036">Table 3</xref>).<italic>E.coli</italic> was isolated from 12% and 18% of the examined fresh chicken breast  and  thigh samples respectively (<xref ref-type="table" rid="idm1843130052">Table 4</xref>). Using serology,<italic>E.coli</italic> serogroups isolated from breast samples were 2 (33.3%) O157:H7 (EHEC), 1 (16.6%) O114:H21 (EPEC), 1(16.6%) O127:H6 (ETEC), and 2 (33.3%) belonged to O26 (EHEC) (<xref ref-type="table" rid="idm1843077300">Table 5</xref>).</p>
      <table-wrap id="idm1843177052">
        <label>Table 2.</label>
        <caption>
          <title> Total aerobic plate count (APC) of examined chicken samples (n =100).</title>
        </caption>
        <table rules="all" frame="box">
          <tbody>
            <tr>
              <td>Chicken meat samples</td>
              <td colspan="5">Total aerobic count (n=100)</td>
            </tr>
            <tr>
              <td/>
              <td colspan="2">Positive samples</td>
              <td colspan="3">Count C.F.U./g</td>
            </tr>
            <tr>
              <td/>
              <td>No.</td>
              <td>%</td>
              <td>Min.</td>
              <td>Max.</td>
              <td>Mean ± SE</td>
            </tr>
            <tr>
              <td>Chicken breasts</td>
              <td>50</td>
              <td>100</td>
              <td>3.5x10<sup>3</sup></td>
              <td>7.2x10<sup>6</sup></td>
              <td>5.1x10<sup>4</sup> ±3.2x10<sup>4</sup></td>
            </tr>
            <tr>
              <td>Chicken thighs</td>
              <td>50</td>
              <td>100</td>
              <td>4.6x10<sup>4</sup></td>
              <td>8.8x10<sup>6</sup></td>
              <td>6.1x10<sup>5</sup> ±5.6x10<sup>5</sup></td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <table-wrap id="idm1843157036">
        <label>Table 3.</label>
        <caption>
          <title> Total Enterobacteriace count (APC) of examined chicken samples (n =50).</title>
        </caption>
        <table rules="all" frame="box">
          <tbody>
            <tr>
              <td>Chicken meat samples</td>
              <td colspan="5">Total  Enterobacteriacae  count (n=48)</td>
            </tr>
            <tr>
              <td/>
              <td colspan="2">Positive samples</td>
              <td colspan="3">Count C.F.U./g</td>
            </tr>
            <tr>
              <td/>
              <td>No.</td>
              <td>%</td>
              <td>Min.</td>
              <td>Max.</td>
              <td>Mean ± SE</td>
            </tr>
            <tr>
              <td>Chicken breasts</td>
              <td>21</td>
              <td>42</td>
              <td>3.1x10<sup>4</sup></td>
              <td>8.2x10<sup>4</sup></td>
              <td>5.9x10<sup>4</sup>±9.7x10<sup>3</sup></td>
            </tr>
            <tr>
              <td>Chicken thighs</td>
              <td>27</td>
              <td>54</td>
              <td>5.4x10<sup>4</sup></td>
              <td>9.6x10<sup>4</sup></td>
              <td>7.1x10<sup>4</sup>±1.1x10<sup>4</sup></td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <table-wrap id="idm1843130052">
        <label>Table 4.</label>
        <caption>
          <title> Prevalence of micro- organisms isolated from examined chicken samples (n =50).</title>
        </caption>
        <table rules="all" frame="box">
          <tbody>
            <tr>
              <td>Micro oragnisms</td>
              <td colspan="4"> Examined chicken samples (n=50)</td>
            </tr>
            <tr>
              <td/>
              <td colspan="2">Chicken breasts</td>
              <td colspan="2">Chicken thighs</td>
            </tr>
            <tr>
              <td/>
              <td>No.</td>
              <td>%<xref ref-type="table-fn" rid="idm1842801868">*</xref></td>
              <td>No.</td>
              <td>%<xref ref-type="table-fn" rid="idm1842801868">*</xref></td>
            </tr>
            <tr>
              <td>Staphylococcus aureus</td>
              <td>5</td>
              <td>10</td>
              <td>2</td>
              <td>4</td>
            </tr>
            <tr>
              <td>Salmonella</td>
              <td>7</td>
              <td>14</td>
              <td>4</td>
              <td>8</td>
            </tr>
            <tr>
              <td>Escherichia coli</td>
              <td>6</td>
              <td>12</td>
              <td>9</td>
              <td>18</td>
            </tr>
            <tr>
              <td>Klebsiella sp.</td>
              <td>0</td>
              <td>0</td>
              <td>2</td>
              <td>4</td>
            </tr>
            <tr>
              <td>Enterobacter sp.</td>
              <td>2</td>
              <td>4</td>
              <td>1</td>
              <td>2</td>
            </tr>
            <tr>
              <td>Proteus sp</td>
              <td>1</td>
              <td>2</td>
              <td>1</td>
              <td>2</td>
            </tr>
            <tr>
              <td>Shigella sp.</td>
              <td>1</td>
              <td>2</td>
              <td>0</td>
              <td>0</td>
            </tr>
            <tr>
              <td>Clostridium perfringens</td>
              <td>8</td>
              <td>16</td>
              <td>5</td>
              <td>10</td>
            </tr>
            <tr>
              <td>total</td>
              <td>30</td>
              <td>60</td>
              <td>24</td>
              <td>48</td>
            </tr>
          </tbody>
        </table>
        <table-wrap-foot>
          <fn id="idm1842801868">
            <label>*</label>
            <p>percent calculated according to total number of samples</p>
          </fn>
        </table-wrap-foot>
      </table-wrap>
      <table-wrap id="idm1843077300">
        <label>Table 5.</label>
        <caption>
          <title> serotyping of E. coli spp. isolated from examined chicken samples (n =50).</title>
        </caption>
        <table rules="all" frame="box">
          <tbody>
            <tr>
              <td>E coli spp.</td>
              <td colspan="4"> Examined chicken samples (n=50)</td>
            </tr>
            <tr>
              <td/>
              <td colspan="2">Chicken breasts isolates (n=6)</td>
              <td colspan="2">Chicken thighs isolates (n=9)</td>
            </tr>
            <tr>
              <td/>
              <td>No.</td>
              <td>%<xref ref-type="table-fn" rid="idm1842777020">*</xref></td>
              <td>No.</td>
              <td>%<xref ref-type="table-fn" rid="idm1842777020">*</xref></td>
            </tr>
            <tr>
              <td>O<sub>157</sub>:H<sub>7</sub> (EHEC)</td>
              <td>2</td>
              <td>33.3</td>
              <td>2</td>
              <td>22.2</td>
            </tr>
            <tr>
              <td>O114:H21(EPEC)</td>
              <td>1</td>
              <td>16.6</td>
              <td>1</td>
              <td>11.1</td>
            </tr>
            <tr>
              <td>O127:H6 (ETEC)</td>
              <td>1</td>
              <td>16.6</td>
              <td>3</td>
              <td>33.3</td>
            </tr>
            <tr>
              <td>O126 (ETEC)</td>
              <td>0</td>
              <td>0</td>
              <td>3</td>
              <td>33.3</td>
            </tr>
            <tr>
              <td>O26 (EHEC)</td>
              <td>2</td>
              <td>33.3</td>
              <td>0</td>
              <td>0</td>
            </tr>
          </tbody>
        </table>
        <table-wrap-foot>
          <fn id="idm1842777020">
            <label>*</label>
            <p>percent calculated according to total number of isolates</p>
          </fn>
        </table-wrap-foot>
      </table-wrap>
      <p>Similarly, <italic>E.cloi</italic> isolates from thigh samples were 2(22.2%) O157:H7 (EHEC), 1(11.1) O114:H21 (EPEC), 3(33.3) O127:H6 (ETEC), and 3(33.3) belonged to O126 (ETEC) .All 100% of the identified <italic>Ecoli</italic><italic> O</italic><sub><italic>157,</italic></sub>isolates from chicken meat samples were positive by PCR (<xref ref-type="table" rid="idm1843051380">Table 6</xref>, <xref ref-type="fig" rid="idm1843012420">Figure 1</xref>).</p>
      <table-wrap id="idm1843051380">
        <label>Table 6.</label>
        <caption>
          <title> Using PCR for detection of Ecoli o157.</title>
        </caption>
        <table rules="all" frame="box">
          <tbody>
            <tr>
              <td>Examined isolates</td>
              <td colspan="2">Number of positive samples</td>
              <td>%</td>
            </tr>
            <tr>
              <td/>
              <td>Traditional methods</td>
              <td>PCR</td>
              <td> </td>
            </tr>
            <tr>
              <td/>
              <td>No.</td>
              <td>No.</td>
              <td> </td>
            </tr>
            <tr>
              <td>Ecoli o<sub>157</sub></td>
              <td>4</td>
              <td>4</td>
              <td>100</td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <fig id="idm1843012420">
        <label>Figure 1.</label>
        <caption>
          <title> positive gene amplification at 625bp for Ecoli O157.</title>
        </caption>
        <graphic xlink:href="images/image1.jpg" mime-subtype="jpg"/>
      </fig>
    </sec>
    <sec id="idm1842765716" sec-type="discussion">
      <title>Discussion </title>
      <p>Aerobic Plate Count gives an idea about the hygienic measures applied during processing to helps in the determination of the keeping quality of the poultry carcasses. Similar results were reported <xref ref-type="bibr" rid="ridm1842550724">17</xref> for chicken thigh samples for where APC was 2.5×10⁵ cfu/g and <xref ref-type="bibr" rid="ridm1842530316">18</xref> for breast samples where APC was 243.90×10⁴cfu/g and 69.60 ×10⁴cfu/g. On the other hand, higher counts were reported <xref ref-type="bibr" rid="ridm1842527940">19</xref>with values of 3.38x10⁶±1.02x10⁶cfu/g. Aerobic plate counts were 1.75×10<sup>5</sup>±1.6×10<sup>5</sup>cfu/g in freshly slaughtered breast meat samples<xref ref-type="bibr" rid="ridm1842523692">20</xref>.            Comparatively, lower counts were reported by<xref ref-type="bibr" rid="ridm1842521604">21</xref>where APCwas 4.2 ×10<sup>2</sup> cfu/g in raw chicken breast samples Similarly, it was found that APC in examined chicken thigh samples were 6.84×10<sup>5</sup> ±1.65×10<sup>4</sup>cfu/g <xref ref-type="bibr" rid="ridm1842517500">22</xref>. </p>
      <sec id="idm1842763124">
        <title>Total Enterobacteriaceae Count (TEC)</title>
        <p>Enterobacteriaeace count is more frequently used to assess enteric contamination. Nearly similar results were reported bywhich <italic>Enterobacteriaeace</italic> counts were 5.26×10⁴ in examined chicken                       breast muscle samples <xref ref-type="bibr" rid="ridm1842532116">23</xref><bold>. </bold>In a similar study it was reported that <italic>Enterobacteriaeace</italic> counts were 9.5×10⁴±0.9×10⁴cfu/g in examined chicken breast samples<xref ref-type="bibr" rid="ridm1842523692">20</xref>. In addition, higher counts of                    <italic>Enterobacteriacae</italic>counts were reported (3.9 ×10⁵ and 3×10⁵ cfu/g, respectively)<xref ref-type="bibr" rid="ridm1842532548">24</xref> in chicken thighs and breast samples tested microbiologically<xref ref-type="bibr" rid="ridm1842531324">25</xref>.Another investigator reported that<italic>Enterobacteriaeace</italic> counts in examined chicken carcasses samples were 1.57-2.17×10⁶cfu/g<xref ref-type="bibr" rid="ridm1842531324">25</xref>. On the other hand, a lower count was reported by<xref ref-type="bibr" rid="ridm1842507540">26</xref> in which the  mean counts of <italic>Enterobacteriacae</italic> in chicken breast  samples was 1.5×10³±2.3×10² cfu/g.</p>
      </sec>
      <sec id="idm1842759956">
        <title>Prevalance and Serotyping of Escherichia coli. Isolated from the Examined Chicken Samples</title>
        <p>The presence of <italic>E.coli</italic> in food of animal origin is considered as an indicator of faults during preparation, handling, storage or service<xref ref-type="bibr" rid="ridm1842504444">27</xref>. Nearly similar results were reported <italic>E.coli</italic>was isolatedfrom 13.33%  thigh samples<xref ref-type="bibr" rid="ridm1842503364">28</xref>. Moreover higher percentages of<italic> Escherichia coli</italic> were reported by<xref ref-type="bibr" rid="ridm1842500268">29</xref>who founded that the prevalence and load of  <italic>E</italic><italic>.coli</italic> in chicken meat sold in retail market in Uttar Pradesh was 68% of the examined samples,<xref ref-type="bibr" rid="ridm1842499476">30</xref> who reported that 45% of the chicken samples collected from retail outlets were positive for <italic>E.coli.</italic> On the other hand<xref ref-type="bibr" rid="ridm1842521604">21</xref> failed to detect <italic>E. coli</italic> O157:H6 targeted samples, whereas only 2% positive samples were reported out of 50 tested<xref ref-type="bibr" rid="ridm1842511788">31</xref>. </p>
        <p>Using serology O<sub>157</sub>:H<sub>7</sub> (EHEC),1(16.6%)              which was belonged to O114:H21(EPEC), O127:H6 (ETEC) and O26 (EHEC) were identified from breast sampls,. while, O<sub>157</sub>:H<sub>7</sub> (EHEC), O114:H21(EPEC) ,O127:H6 (ETEC) and O126 (ETEC) were identified from thigh samples.</p>
        <p>Enterotoxigenic <italic>E.coli</italic> (ETEC) strains are considered the common cause of traveller`s diarrhea and / or children diarrhea. ETEC may contaminate ready to eat food through a symptomatic carrier, a person who recovers from an ETEC infection and continue to excrete the organism for several months.</p>
        <p>On the other hand, Enteroheamorrhagic <italic>E.coli</italic> (EHEC) can cause sever illnesses characterized by sudden onset of severe crampy abdominal pain followed by watery diarrhea, which later on becomes bloody. There may be little or no fever and the duration of illness is 2 to 9 days. Death rate in some reported outbreaks may reach 36%. Since 1982, more than 10650 outbreaks of EHEC were reported in USA<xref ref-type="bibr" rid="ridm1842509988">32</xref>.</p>
      </sec>
      <sec id="idm1842734188">
        <title>Polymerase Chain Reaction (PCR)    </title>
        <p>All 100% of <italic>Ecoli</italic><italic> o</italic><sub><italic>157,</italic></sub> isolates identifiedserologically from chicken meat samples were positive by PCR. Thus there was complete agreement between the results of serological methods and PCR technique for  identification of <italic>Ecoli</italic><italic> o</italic><sub><italic>157</italic></sub><sub>. </sub>Accordingly, the application of one of these trials is sufficient and accurate for identification of such organism.</p>
        <p>This agrees with the report<xref ref-type="bibr" rid="ridm1842487564">33</xref> who  observed similar findings between multiplex PCR and microbiological/biochemical methods Microbiological method is still the method of  choice of isolation and identification of food pathogens owing to its availability and ease of application.</p>
      </sec>
    </sec>
  </body>
  <back>
    <ref-list>
      <ref id="ridm1842708428">
        <label>1.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <article-title>(FAO)FoodandAgricultureOraganization.(2014).The role of poultry in human nutrition available at: www FAO.org/ docrp/ 013/ a1713e/a1713e00</article-title>
        </mixed-citation>
      </ref>
      <ref id="ridm1842709148">
        <label>2.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Cason</surname>
            <given-names>J A</given-names>
          </name>
          <name>
            <surname>Hinton</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Ingram</surname>
            <given-names>K D</given-names>
          </name>
          <article-title>Coliform, Escherichia coli, and Salmonella concentration in a multiple-tank, counter flow poultry scalder.J. Food</article-title>
          <date>
            <year>2000</year>
          </date>
          <chapter-title>Prot.63:</chapter-title>
          <fpage>1184</fpage>
          <lpage>1188</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842701948">
        <label>3.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Adeyanju</surname>
            <given-names>G T</given-names>
          </name>
          <name>
            <surname>Ishola</surname>
            <given-names>O</given-names>
          </name>
          <article-title>Salmonella and Escherichia coli contamination of poultry meat from a processing plant and retail markets in Ibadan</article-title>
          <date>
            <year>2014</year>
          </date>
          <volume>3</volume>
          <fpage>13914</fpage>
          <lpage>7</lpage>
          <publisher-name>Springer</publisher-name>
          <publisher-loc>Oyo State, Nigeria</publisher-loc>
        </mixed-citation>
      </ref>
      <ref id="ridm1842718556">
        <label>4.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Doyle</surname>
            <given-names>M P</given-names>
          </name>
          <name>
            <surname>Robert</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Buchanan</surname>
            <given-names/>
          </name>
          <chapter-title>(1997).Food borne disease Significance ofE.coli O157 :H7and other EnterohemorhagicE.coli. J.of Food Technology</chapter-title>
          <volume>51</volume>
          <issue>10</issue>
        </mixed-citation>
      </ref>
      <ref id="ridm1842780492">
        <label>5.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Jasson</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>Jacxsens</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Luning</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Rajkovic</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Uyttendaele</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Alternative microbial methods: An overview and selection criteria</article-title>
          <date>
            <year>2011</year>
          </date>
          <source>Food Microbiol</source>
          <volume>27</volume>
          <fpage>710</fpage>
          <lpage>730</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842571172">
        <label>6.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Malorny</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>Tassios</surname>
            <given-names>P T</given-names>
          </name>
          <name>
            <surname>Radstrom</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Cook</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Wagner</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Standardization of diagnostic PCR for the detection of foodborne pathogens</article-title>
          <date>
            <year>2003</year>
          </date>
          <source>Int J Food Microbiol</source>
          <volume>83</volume>
          <fpage>39</fpage>
          <lpage>48</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842569300">
        <label>7.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <article-title>Hill,W.E.(1996): The polymerase chain reaction: application for the detection foodborne pathogens</article-title>
          <source>CRC Crit Rev Food Sci Nutrit</source>
          <volume>36</volume>
          <fpage>123</fpage>
          <lpage>173</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842567212">
        <label>8.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>J</surname>
            <given-names>L McKillip</given-names>
          </name>
          <name>
            <surname>Drake</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Real-time nucleic acid-based detectionmethods for pathogenic bacteria in food</article-title>
          <date>
            <year>2004</year>
          </date>
          <source>J Food Prot</source>
          <volume>67</volume>
          <fpage>823</fpage>
          <lpage>832</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842572324">
        <label>9.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <article-title>International Commission on Microbiological Specification for Foods˵ ICMSF˶(1978): Microorganisms in foods. their significance and methods of enumeration (2nd ed). University of Toronto press</article-title>
          <publisher-loc>Toronto Canada</publisher-loc>
        </mixed-citation>
      </ref>
      <ref id="ridm1842560972">
        <label>10.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>USDA</surname>
            <given-names/>
          </name>
          <article-title>Quantitative Analysis of Bacteria in Foods as Sanitary Indicators</article-title>
          <date>
            <year>2011</year>
          </date>
        </mixed-citation>
      </ref>
      <ref id="ridm1842557444">
        <label>11.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>ISO</surname>
            <given-names/>
          </name>
          <article-title>International Organization for Standardization Microbiology food</article-title>
          <date>
            <year>2001</year>
          </date>
        </mixed-citation>
      </ref>
      <ref id="ridm1842559172">
        <label>12.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>American</surname>
            <given-names>Public</given-names>
          </name>
          <article-title>Health Association.(1992).Compendium of methods for microbiological examination of Food</article-title>
          <chapter-title>3rdEd</chapter-title>
          <publisher-loc>Brothers, Ann, Arb</publisher-loc>
        </mixed-citation>
      </ref>
      <ref id="ridm1842556148">
        <label>13.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Hu</surname>
            <given-names>Q</given-names>
          </name>
          <name>
            <surname>Tu</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Han</surname>
            <given-names>X</given-names>
          </name>
          <name>
            <surname>Zhu</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Ding</surname>
            <given-names>C</given-names>
          </name>
          <article-title>Development of multiplex PCR assay for rapid detection of Riemerella anatipestifer Esherichia coli and salmonella enterica simultaneously from ducks</article-title>
          <date>
            <year>2011</year>
          </date>
          <source>J. Microbiol.Methods,87:</source>
          <fpage>64</fpage>
          <lpage>69</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842550004">
        <label>14.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Dipineto</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Santaniello</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Fontanella</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Lagos</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Fioretti</surname>
            <given-names/>
          </name>
          <chapter-title>A.,Menna,LF.(2006). Presence of Shiga toxin-producingE.coliO157: H in living layer hens. Letters in Applied Microbiol</chapter-title>
          <volume>43</volume>
          <fpage>293</fpage>
          <lpage>295</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842546692">
        <label>15.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>P</surname>
            <given-names>M Fratamico</given-names>
          </name>
          <name>
            <surname>Bagi</surname>
            <given-names>L K andPepe</given-names>
          </name>
          <name>
            <surname>T</surname>
            <given-names/>
          </name>
          <article-title>A multiplex polymerase chain reaction assay for rapid detection and identification of Escherichia coli</article-title>
          <date>
            <year>2000</year>
          </date>
          <chapter-title>O157:H7 in foods and bovine feces.J Food Prot.;63(8):</chapter-title>
          <fpage>1032</fpage>
          <lpage>7</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842551516">
        <label>16.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Feldman</surname>
            <given-names>D</given-names>
          </name>
          <article-title>The solution for data analysis and presentation graphics. 2nd Ed., Abacus Lancripts, Inc</article-title>
          <date>
            <year>2003</year>
          </date>
          <publisher-loc>Berkeley, USA</publisher-loc>
        </mixed-citation>
      </ref>
      <ref id="ridm1842550724">
        <label>17.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>E</surname>
            <given-names>A Morshedy</given-names>
          </name>
          <article-title>A .M .and Sallam ,K .I.(2002):Improving of Sanitary status of broiler carcasses during their processing </article-title>
          <chapter-title>6thVet. Med . Zagazig. Conference (7-9 sept.2002)</chapter-title>
          <publisher-loc>Hurghada</publisher-loc>
        </mixed-citation>
      </ref>
      <ref id="ridm1842530316">
        <label>18.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Sengupta</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Da</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>andMukhopadhayay Ganguly</given-names>
          </name>
          <name>
            <surname>K</surname>
            <given-names>S</given-names>
          </name>
          <article-title>Survey on microbial quality of chicken meat</article-title>
          <date>
            <year>2011</year>
          </date>
          <chapter-title>in Kolkata, India. International J.of Researchin pure and Applied Microbiology</chapter-title>
          <volume>1</volume>
          <issue>3</issue>
          <fpage>32</fpage>
          <lpage>33</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842527940">
        <label>19.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Morshdy</surname>
            <given-names>A M A</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>E Hafez</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>M Mostafa</given-names>
          </name>
          <name>
            <surname>EL-Sayed</surname>
            <given-names>O</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names/>
          </name>
          <article-title>Bacterial evaluation of marketed chicken carcasses inDakahliaProvince and improvement with lactic acid</article-title>
          <date>
            <year>2008</year>
          </date>
          <source>Zag. Vet</source>
          <volume>36</volume>
          <issue>5</issue>
          <fpage>93</fpage>
          <lpage>100</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842523692">
        <label>20.</label>
        <mixed-citation xlink:type="simple" publication-type="journal"><name><surname>F</surname><given-names>N EI-Shopary</given-names></name><article-title>Effect of antibiotic residues on the sanitary statusand storage period of poultry meat.Ph .D.Thesis (Meat Hygiene) .Fac</article-title><date><year>2013</year></date>
Vet.Med. Zagazig.Univ.Egypt


</mixed-citation>
      </ref>
      <ref id="ridm1842521604">
        <label>21.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Allah</surname>
            <given-names>Abd</given-names>
          </name>
          <name>
            <surname>H</surname>
            <given-names>W</given-names>
          </name>
          <article-title>andHassan,A.A.(2000): Sanitary status of ready to eat meat meals incairoand Giza Governorates.J .Egypt</article-title>
          <source>Vet. Med</source>
          <volume>60</volume>
          <issue>7</issue>
          <fpage>95</fpage>
          <lpage>104</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842517500">
        <label>22.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Mousa</surname>
            <given-names>M M</given-names>
          </name>
          <name>
            <surname>Bkhiet</surname>
            <given-names/>
          </name>
          <article-title>AA,Abd-ElTawabE.(2000).Bacteriological aspect of pre-cooked deboned poultry meat inDamanhour</article-title>
          <chapter-title>The second International Scientific Conference.The roleof Vet. Med. Mansoura Univ:</chapter-title>
          <fpage>255</fpage>
          <lpage>268</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842532116">
        <label>23.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <article-title>Ola,A.e.(2007):Hygienic evaluation of poultry carcasses.ZagazigUniv</article-title>
          <source>Egypt. Fac. Vet. Med</source>
        </mixed-citation>
      </ref>
      <ref id="ridm1842532548">
        <label>24.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <article-title>Osman ,E.M.S.(2001): Quality assurance of locally dressed broiler´s cuts and theirproducts.CairoUniv,Facof vet Med </article-title>
        </mixed-citation>
      </ref>
      <ref id="ridm1842531324">
        <label>25.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>S</surname>
            <given-names>N Rindhe</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>N Zanjad</given-names>
          </name>
          <name>
            <surname>V</surname>
            <given-names>K Doifode</given-names>
          </name>
          <name>
            <surname>Siddique</surname>
            <given-names/>
          </name>
          <article-title>A .andMendheM.S. (2008): Assessment of microbial contamination of Chicken products sold inParbhanicity.VeterinaryWorld,1(7):</article-title>
          <fpage>208</fpage>
          <lpage>212</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842507540">
        <label>26.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <article-title>Tolba K.(2000):Sanitary status of marketed frozen chicken productsexhibited in presentation freezer</article-title>
          <source>J. of VeterinaryMedecine, Giza</source>
          <volume>217</volume>
        </mixed-citation>
      </ref>
      <ref id="ridm1842504444">
        <label>27.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <article-title>Tebbut,G.M.(1999): Microbiological contamination of cooked meats International Commission on and environmental site in premise selling both raw and cooked meat products</article-title>
          <source>Int. J. Environm. Health Research</source>
          <volume>3</volume>
          <issue>4</issue>
          <fpage>209</fpage>
          <lpage>216</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842503364">
        <label>28.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Ibrahim</surname>
            <given-names>H M</given-names>
          </name>
          <name>
            <surname>Amin</surname>
            <given-names>R A</given-names>
          </name>
          <name>
            <surname>El-Shater</surname>
            <given-names>M A</given-names>
          </name>
          <name>
            <surname>Hafez</surname>
            <given-names>Salwa M</given-names>
          </name>
          <article-title>Bacteriological evaluation of freshly slaughtered chicken carcasses</article-title>
          <date>
            <year>2015</year>
          </date>
          <source>Benha. Vet. Med.J,28</source>
          <volume>2</volume>
          <fpage>74</fpage>
          <lpage>82</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842500268">
        <label>29.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Joshi</surname>
            <given-names/>
          </name>
          <article-title>and Joshi ,R.K.(2010): Bacteriological quality of meat sold in retail market in Uttar Pradesh</article-title>
          <source>J. of Veterinarian Public Health</source>
          <volume>8</volume>
          <issue>2</issue>
          <fpage>137</fpage>
          <lpage>139</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842499476">
        <label>30.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Ahmed</surname>
            <given-names>M U D</given-names>
          </name>
          <name>
            <surname>Sarwar</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>I Najeeb</given-names>
          </name>
          <name>
            <surname>Nawaz</surname>
            <given-names>M</given-names>
          </name>
          <article-title>assessment of microbial load of raw meat at abattoirs and retail outlets.The</article-title>
          <date>
            <year>2013</year>
          </date>
          <source>Journal of Animal &amp; Plant Sciences</source>
          <volume>23</volume>
          <issue>3</issue>
          <fpage>745</fpage>
          <lpage>748</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842511788">
        <label>31.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>C</surname>
            <given-names>B Kiranmayi</given-names>
          </name>
          <name>
            <surname>Krishnaiah</surname>
            <given-names>N</given-names>
          </name>
          <article-title>Detection of E.coli O157 H7 prevalance in foods of animal origin by cultural methods and PCR technique. Veterinary World</article-title>
          <date>
            <year>2010</year>
          </date>
          <volume>3</volume>
          <issue>1</issue>
          <fpage>13</fpage>
          <lpage>16</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842509988">
        <label>32.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>World</surname>
            <given-names>Health Organization</given-names>
          </name>
          <article-title>Consultation on prevention and control of EHEC infections. World Health Organization</article-title>
          <date>
            <year>1997</year>
          </date>
          <publisher-loc>Geneva, Switzerland</publisher-loc>
        </mixed-citation>
      </ref>
      <ref id="ridm1842487564">
        <label>33.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Asensi</surname>
            <given-names>G F</given-names>
          </name>
          <name>
            <surname>dos</surname>
            <given-names>Reis EMF</given-names>
          </name>
          <name>
            <surname>Del</surname>
            <given-names>Aguila EMD</given-names>
          </name>
          <article-title>Detection of Escherichia coli and Salmonella in chicken rinse carcasses&amp;quot;</article-title>
          <date>
            <year>2009</year>
          </date>
          <source>British Food Journal</source>
          <volume>111</volume>
          <issue>6</issue>
          <fpage>517</fpage>
          <lpage>527</lpage>
        </mixed-citation>
      </ref>
    </ref-list>
  </back>
</article>
